Home

Rosalind #2: Transcribing DNA into RNA

An RNA string is a string formed from the alphabet containing 'A', 'C', 'G', and 'U'.

Given a DNA string $t$ corresponding to a coding strand, its transcribed RNA string $u$ is formed by replacing all occurrences of 'T' in $t$ with 'U' in $u$ .

Given: A DNA string $t$ having length at most 1000 nt.

Return: The transcribed RNA string of $t$ .

🔗 Sample Dataset

GATGGAACTTGACTACGTAAATT

🔗 Sample Output

GAUGGAACUUGACUACGUAAAUU

🔗 Solution

Using Blocks, we can apply an anonymous function to a value, where 𝕩 is the argument to the function.

   { 𝕩 + 5 } 2
7

Blocks also support “Case headers,” allowing us to write if-statements.

   { 
     5: "Five!" ;
     𝕩 + 2
   } 5
"Five!"
   { 
     5: "Five!" ;
     𝕩 + 2
   } 3
5

We can replace the character ‘T’ with the character ‘U’.

   { 'T' : 'U' } 'T'
'U'

But we need a default case.

   {'T':'U'} 'A'
Error: No header matched argument
   {'T':'U';𝕩} 'A'
'A'

We can apply our function to a list (or a string of characters) with 𝔽¨ 𝕩, 𝕨 𝔽¨ 𝕩: Each.

   {'T':'U';𝕩}¨ "LETS GO"
"LEUS GO"

We can replace T’s in our DNA string with U’s.

   Rosalind2 ← {'T':'U';𝕩}¨
(function block)¨
   Rosalind2 "GATGGAACTTGACTACGTAAATT"
"GAUGGAACUUGACUACGUAAAUU"